Journal: International Journal of Molecular Sciences

Article Title: The Selective 3-MST Inhibitor I3MT-3 Works as a Potent Caspase-1 Inhibitor

doi: 10.3390/ijms26052237

Figure Lengend Snippet: I3MT-3 exerts an inhibitory effect on inflammasome activation by targeting caspase-1 but not ASC. ( A , B ) HEK293A cells were transfected with plasmids of pro-caspase-1 and pro-IL-1β for 6 h, followed by overnight treatment with the above concentrations of I3MT-3. Cell-free supernatants (Sup) and cell lysates were subjected to immunoblotting with the indicated antibodies ( A ). IL-1β release was analyzed by ELISA ( B ). Data shown are the mean ± S.D. Significant differences were determined by one-way ANOVA, followed by the Tukey–Kramer test; *** p < 0.001. ( C ) BMDMs were treated with the indicated concentrations of I3MT-3 and 100 ng/mL LPS for 4 h, and then treated with 1 mM ATP for 1.5 h. Cell-free supernatants (Sup) and cell lysates were subjected to immunoblotting with the indicated antibodies. ( D ) PMA-differentiated ASC KO THP-1 cells were pretreated with 50 µM I3MT-3 for 1 h and then treated with 1 μM Talabostat for 3 h. Cell-free supernatants (Sup) and cell lysates were subjected to immunoblotting with the indicated antibodies. ( E ) HEK293A cells were transfected with plasmids of Flag-pro-caspase-1 for 24 h and then treated with 50 μM I3MT-3 or 50 μM VX-765 for 4 h. Purified Flag-caspase-1 was incubated for 20 min at RT in assay buffer. Then Ac-WEHD-pNA Colorimetric substrate 100 µM was added, and it was incubated at 37 °C for 2 h. Activity was measured using a microplate reader and the absorbance was read at 405 nm. Data shown are the mean ± S.D. Significant differences were determined by one-way ANOVA, followed by the Tukey–Kramer test; *** p < 0.001. ( F ) HT1080 cells were pretreated with the indicated concentrations of I3MT-3 for 24 h and then treated with 50 ng/mL FasL for 4 h. Cell lysates were subjected to immunoblotting with the indicated antibodies. ( G ) HEK293A cells were transfected with plasmids of Flag-pro-caspase-3 for 24 h and then treated with 50 μM I3MT-3 or 20 μM z-VAD-fmk for 4 h. Caspase-3 activity was measured by the Colorimetric caspase-3 assay. Data are shown as the ratio of caspase-3 activity versus the corresponding controls. Data shown are the mean ± S.D. Significant differences were determined by one-way ANOVA, followed by the Tukey–Kramer test; *** p < 0.001, N.S. not significant.

Article Snippet: Human monocytic leukemia cell line THP-1 and human fibrosarcoma cell line HT1080 were obtained from the JCRB Cell Bank (Japanese Collection of Research Bioresources Cell Bank) [ ].

Techniques: Activation Assay, Transfection, Western Blot, Enzyme-linked Immunosorbent Assay, Purification, Incubation, Activity Assay, Caspase-3 Assay

Journal: The Journal of Biological Chemistry

Article Title: Reactive sulfur species disaggregate the SQSTM1/p62-based aggresome-like induced structures via the HSP70 induction and prevent parthanatos

doi: 10.1016/j.jbc.2023.104710

Figure Lengend Snippet: RSS suppress oxidative stress–induced parthanatos. A , HT1080 cells were treated with CTX (1 mg/ml) and/or rucaparib (1 μM) for 42 h. Cell viability was determined by PMS/MTS assay. Data shown are the mean ± SEM (n = 3). Significant differences were determined by one-way ANOVA, followed by Tukey–Kramer test; ∗∗∗ p < 0.001, ( versus control cells), ### p < 0.001 ( versus CTX 1 mg/ml, rucaparib 0 μM cells). B , HT1080 and PARP-1 KO HT1080 were treated with CTX (1 mg/ml) for 48 h. Cell viability was determined by PMS/MTS assay. Data shown are the mean ± SEM (n = 3). Significant differences were determined by one-way ANOVA, followed by Tukey–Kramer test; ∗∗∗ p < 0.001, ( versus WT control cells), ### p < 0.001 ( versus WT CTX 1 mg/ml cells). C , HT1080 cells were treated with CTX (1 mg/ml) with indicated concentration of Na 2 S 4 for 48 h. Cell viability was determined by PMS/MTS assay. Data shown are the mean ± SEM (n = 3). Statistical significance was tested using an unpaired Student’s t test; ∗∗ p < 0.01, ( versus control cells), # p < 0.05, ( versus CTX 1 mg/ml, Na 2 S 4 0 μM cells). D , HT1080 cells were treated with CTX (1 mg/ml) with indicated concentration of Na 2 S 4 for 48 h. Dead cells were labeled with PI for 15 min and analyzed by FACS. Data shown are the mean ± SEM (n = 3). Significant differences were determined by one-way ANOVA, followed by Tukey–Kramer test; ∗∗∗ p < 0.001, ( versus control cells), ## p < 0.01, ### p < 0.001, ( versus CTX 1 mg/ml, Na 2 S 4 0 μM cells). E , HT1080 cells were treated with CTX (1 mg/ml) and/or Na 2 S 4 (100 μM) for 36 h or CHX (10 μg/ml) and TNF-α (25 μg/ml) for 12 h. Cell lysates were subjected to immunoblotting with the indicated antibodies. F , nuclear AIF expressions were quantified using Image Lab software from Bio-Rad. Graphs depict the mean ± SEM of three independent experiments. Significant differences were determined by one-way ANOVA, followed by Tukey–Kramer test; ∗∗ p < 0.01 ( versus CTX 1 mg/ml, Na 2 S 4 0 μM cells). G , HT1080 cells were treated with CTX (1 mg/ml) with indicated concentration of I3MT-3 for 48 h. Cell viability was determined by PMS/MTS assay. Data shown are the mean ± SEM (n = 3). Significant differences were determined by one-way ANOVA, followed by Tukey–Kramer test; ∗∗ p < 0.01, ∗∗∗ < 0.001 ( versus CTX 1 mg/ml, I3MT-3 0 μM cells). H , HT1080 cells were treated with CTX (1 mg/ml) and/or I3MT-3 (10 μM) for 48 h. Dead cells were labeled with PI for 15 min and analyzed by FACS. Data shown are the mean ± SEM (n = 3). Significant differences were determined by one-way ANOVA, followed by Tukey–Kramer test; ∗∗∗ p < 0.001, ( versus control cells), ### p < 0.001, ( versus CTX 1 mg/ml, I3MT-3 0 μM cells). I , HT1080 cells were treated with CTX (1 mg/ml) and/or I3MT-3 (10 μM) for 36 h. Cell lysates were subjected to immunoblotting with the indicated antibodies. J , nuclear AIF expressions were quantified using Image Lab software from Bio-Rad. Graphs depict the mean ± SEM of three independent experiments. Significant differences were determined by one-way ANOVA, followed by Tukey–Kramer test; ∗∗ p < 0.01 ( versus CTX 1 mg/ml, I3MT-3 0 μM cells). K , HT1080 cells were treated with CTX (1 mg/ml) with the indicated concentration of PAG for 24 h. Cell viability was determined by PMS/MTS assay. Data shown are the mean ± SEM (n = 3). Significant differences were determined by one-way ANOVA, followed by Tukey–Kramer test; ∗∗ p < 0.051, ∗∗∗ < 0.001 ( versus CTX 1 mg/ml, PAG 0 mM cells). L , HT1080 cells were treated with CTX (1 mg/ml) with the indicated concentration of PAG for 24 h. Dead cells were labeled with PI for 15 min and analyzed by FACS. Data shown are the mean ± SEM (n = 3). Significant differences were determined by one-way ANOVA, followed by Tukey–Kramer test; ∗∗∗ p < 0.001, ( versus CTX 1 mg/ml, PAG 0 mM cells). M , HT1080 cells were treated with CTX (1 mg/ml) and/or PAG (5 mM) for 36 h. Cell lysates were subjected to immunoblotting with the indicated antibodies. N , nuclear AIF expressions were quantified using Image Lab software from Bio-Rad. Graphs depict the mean ± SEM of three independent experiments. Significant differences were determined by one-way ANOVA, followed by Tukey–Kramer test; ∗ p < 0.05 ( versus CTX 1 mg/ml, PAG 0 mM cells). All data are representative of at least three independent experiments. AIF, apoptosis-inducing factor; CHX, cycloheximide; CTX, cefotaxime; FACS, fluorescence-activated cell sorting; MTS, 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium; PAG, DL-propargylglycine; PARP-1, poly (ADP-ribose) polymerase-1; PI, propidium iodide; PMS, phenazine methosulfate; RSS, reactive sulfur species.

Article Snippet: HT1080 cells were transfected with 10 nM nontargeting siRNA pool (Dharmacon) as control or HSP70 siRNAs using Lipofectamine RNAiMAX Transfection Reagent (Invitrogen), according to the manufacturer’s instructions.

Techniques: MTS Assay, Control, Concentration Assay, Labeling, Western Blot, Software, Fluorescence, FACS

Journal: The Journal of Biological Chemistry

Article Title: Reactive sulfur species disaggregate the SQSTM1/p62-based aggresome-like induced structures via the HSP70 induction and prevent parthanatos

doi: 10.1016/j.jbc.2023.104710

Figure Lengend Snippet: RSS suppress the ALIS formation. A , HT1080 and p62 KO HT1080 cells were treated with CTX (1 mg/ml) for 24 h, and then the detergent-soluble and detergent-insoluble fractions were subjected to immunoblotting with the indicated antibodies. B , HT1080 cells were treated with CTX (1 mg/ml) for 24 h, then performed immunofluorescence staining with the indicated antibody, and 4′,6-diamidino-2-phenylindole (DAPI) nuclear staining. Scale bar represents 10 μm. C , HT1080 cells were treated with CTX (1 mg/ml) and/or NAC (2 mM) for 24 h, and then the detergent-soluble and detergent-insoluble fractions were subjected to immunoblotting with the indicated antibodies. D , HT1080 cells were treated with CTX (1 mg/ml) and/or rucaparib (1 μM) for 24 h, and then the detergent-soluble and detergent-insoluble fractions were subjected to immunoblotting with the indicated antibodies. E , HT1080 cells were treated with CTX (1 mg/ml) and/or Na 2 S 4 (100 μM) for 24 h, and then the detergent-soluble and detergent-insoluble fractions were subjected to immunoblotting with the indicated antibodies. F , HT1080 cells were treated with CTX (1 mg/ml) and/or Na 2 S 4 (100 μM) for 24 h, then performed immunofluorescence staining with the indicated antibody, and DAPI nuclear staining. Scale bar represents 10 μm. G , the number of p62 and ubiquitin-colocalized puncta were quantified using Image J. Data shown are the mean ± SEM (n = 3). Significant differences were determined by one-way ANOVA, followed by Tukey–Kramer test; ∗∗ p < 0.01, ( versus CTX 1 mg/ml, Na 2 S 4 0 μM cells). H , HT1080 cells were treated with CTX (1 mg/ml) and/or I3MT-3 (10 μM) for 24 h, and then whole cell lysates were subjected to immunoblotting with the indicated antibodies. I , HT1080 cells were treated with CTX (1 mg/ml) and/or PAG (5 mM) for 24 h, and then whole cell lysates were subjected to immunoblotting with the indicated antibodies. J , HT1080 cells were treated with the indicated reagents for 24 h, then performed immunofluorescence staining with the indicated antibody, and DAPI nuclear staining. CTX (1 mg/ml). I3MT-3 (10 μM). PAG (5 mM). Scale bar represents 10 μm. K , the number of p62 and ubiquitin-colocalized puncta were quantified using Image J. Data shown are the mean ± SEM (n = 3). Significant differences were determined by one-way ANOVA, followed by Tukey–Kramer test; ∗∗ p < 0.01, ( versus CTX 1 mg/ml, I3MT-3 0 μM PAG 0 mM cells). All data are representative of at least three independent experiments. ALIS, aggresome-like induced structure; CTX, cefotaxime; PAG, DL-propargylglycine; NAC, N-acetylcysteine; RSS, reactive sulfur species.

Article Snippet: HT1080 cells were transfected with 10 nM nontargeting siRNA pool (Dharmacon) as control or HSP70 siRNAs using Lipofectamine RNAiMAX Transfection Reagent (Invitrogen), according to the manufacturer’s instructions.

Techniques: Western Blot, Immunofluorescence, Staining, Ubiquitin Proteomics

Journal: The Journal of Biological Chemistry

Article Title: Reactive sulfur species disaggregate the SQSTM1/p62-based aggresome-like induced structures via the HSP70 induction and prevent parthanatos

doi: 10.1016/j.jbc.2023.104710

Figure Lengend Snippet: RSS disaggregate the ALIS by inducing HSP70. A , HT1080 cells were treated with the indicated reagents for 24 h and then incubated with 10 μM 2′,7′-dichlorodihydrofluorescein diacetate (DCFH-DA). Quantification of ROS was calculated by detecting the fluorescence intensity of DCFH-DA. CTX (1 mg/ml). PAG (5 mM). I3MT-3 (20 μM). Data shown are the mean ± SEM (n = 3). Significant differences were determined by one-way ANOVA, followed by Tukey–Kramer test; ∗∗∗ p < 0.001, ( versus control cells), ### p < 0.001, ( versus CTX 1 mg/ml, PAG 0 mM, I3MT-3 0 μM cells). B , HT1080 cells were treated with CTX (1 mg/ml) and/or Na 2 S 4 (100 μM) for 24 h and then incubated with 10 μM DCFH-DA. Quantification of ROS was calculated by detecting the fluorescence intensity of DCFH-DA. Data shown are the mean ± SEM (n = 3). Significant differences were determined by one-way ANOVA, followed by Tukey–Kramer test; ∗∗∗ p < 0.001, ( versus control cells), N.S. p > 0.05 ( versus CTX 1 mg/ml Na 2 S 4 0 μM cells). C , HT1080 cells were treated with the indicated reagents for 24 h, and then the detergent-soluble and detergent-insoluble fractions and whole cell lysate were subjected to immunoblotting with the indicated antibodies. Bafilomycin A1 (5 nM). CTX (1 mg/ml). Na 2 S 4 (100 μM). D , HT1080 cells were treated with CTX (1 mg/ml) for 20 h and then treated with MG132 (10 μM) and/or Na 2 S 4 (100 μM) for 4 h. The detergent-soluble and detergent-insoluble fractions and whole cell lysate were subjected to immunoblotting with the indicated antibodies. E , HT1080 cells were treated with the indicated concentration of Na 2 S 4 for 24 h, and then whole cell lysates were subjected to immunoblotting with the indicated antibodies. F , HT1080 cells were treated with Na 2 S 4 (100 μM) for indicated period, and then whole cell lysates were subjected to immunoblotting with the indicated antibodies. G , HT1080 cells were treated with CTX (1 mg/ml) and Na 2 S 4 (100 μM) for 18 h, and then whole cell lysates were subjected to immunoblotting with the indicated antibodies. H , HT1080 cells were treated with CTX (1 mg/ml) and/or rucaparib (1 μM) for 24 h, and then whole cell lysate were subjected to immunoblotting with the indicated antibodies. I , HT1080 and PARP-1 KO cells were treated with Na 2 S 4 (100 μM) for indicated period, and then whole cell lysates were subjected to immunoblotting with the indicated antibodies. J , HT1080 cells were transfected with siRNA for negative control or HSP70 (HSP70 #1 or HSP70 #2). After 24 h, the cells were treated with CTX (1 mg/ml) for 24 h, and then the detergent-soluble and detergent-insoluble fractions were subjected to immunoblotting with the indicated antibodies. K , HT1080 cells were transfected with siRNA for negative control or HSP70 (HSP70 #1 or HSP70 #2). After 24 h, the cells were treated with CTX (1 mg/ml) for 24 h, then performed immunofluorescence staining with the indicated antibody, and 4′,6-diamidino-2-phenylindole (DAPI) nuclear staining. Scale bar represents 10 μm. L , the number of p62 and ubiquitin-colocalized puncta were quantified using Image J. Data shown are the mean ± SEM (n = 3). Significant differences were determined by one-way ANOVA, followed by Tukey–Kramer test; ∗ p < 0.05, ∗∗ p < 0.01, ( versus siRNA Ctr, CTX 1 mg/ml cells). All data are representative of at least three independent experiments. ALIS, aggresome-like induced structure; CTX, cefotaxime; HSP, heat shock protein; PAG, DL-propargylglycine; PARP-1, poly (ADP-ribose) polymerase-1; ROS, reactive oxygen species; RSS, reactive sulfur species.

Article Snippet: HT1080 cells were transfected with 10 nM nontargeting siRNA pool (Dharmacon) as control or HSP70 siRNAs using Lipofectamine RNAiMAX Transfection Reagent (Invitrogen), according to the manufacturer’s instructions.

Techniques: Incubation, Fluorescence, Control, Western Blot, Concentration Assay, Transfection, Negative Control, Immunofluorescence, Staining, Ubiquitin Proteomics

Journal: The Journal of Biological Chemistry

Article Title: Reactive sulfur species disaggregate the SQSTM1/p62-based aggresome-like induced structures via the HSP70 induction and prevent parthanatos

doi: 10.1016/j.jbc.2023.104710

Figure Lengend Snippet: RSS activate HSF1 by promoting its dissociation from HSP90. A , HT1080 cells were treated with the Na 2 S 4 (100 μM) for indicated period, and then the mRNA levels were measured by quantitative real-time PCR. Data shown are the mean ± SEM (n = 3). Statistical significance was tested using an unpaired Student’s t test; ∗∗∗ p < 0.001, ( versus control cells). B , HT1080 cells were treated with the Na 2 S 4 (100 μM) for the indicated period. Cell lysates were subjected to immunoblotting with the indicated antibodies. C , HT1080 cells were treated with the Na 2 S 4 (100 μM) for the indicated period. Cell lysates were subjected to immunoblotting with the indicated antibodies. D , HT1080 and PARP-1 KO cells were treated with the Na 2 S 4 (100 μM) for 6 h. Cell lysates were subjected to immunoblotting with the indicated antibodies. E , HT1080 cells were treated with the Na 2 S 4 (100 μM) and KRIBB11 (10 μM) for 12 h, and then cell lysates were subjected to immunoblotting with the indicated antibodies. F , HT1080 cells were treated with the Na 2 S 4 (100 μM) and KRIBB11 (10 μM) for 12 h, and then the mRNA levels were measured by quantitative real-time PCR. Data shown are the mean ± SEM (n = 3). Significant differences were determined by one-way ANOVA, followed by Tukey–Kramer test; ∗∗ p < 0.01, ( versus control cells), ## p < 0.01 ( versus Na 2 S 4 100 μM, KRIBB11 0 μM cells). G , HT1080 cells were transfected with FLAG-HSP90 and/or Myc-HSF1 plasmid for 24 h and treated with Na 2 S 4 (100 μM) for 4 h, then immunoprecipitated anti-FLAG-tagged agarose beads, and subjected to immunoblotting with the indicated antibodies. H , HT1080 cells were treated with indicated concentration of Na 2 S 4 for 4 h, then immunoprecipitated protein G-Sepharose beads with the indicated antibodies, and subjected to immunoblotting with the indicated antibodies. I , HSP90 was immunoprecipitated using anti-HSP90 antibody with protein G beads. Beads were washed four times with PBS and then treated with Na 2 S 4 (100, 1000 μM) for 1 h. After reaction, beads were washed four times with PBS and subjected to immunoblotting with the indicated antibodies. J , HT1080 cells were transfected with FLAG-HSP90 (WT/C412A/C564A/C521A) and Myc-HSF1 plasmid for 24 h and treated with Na 2 S 4 (100 μM) for 4 h, then immunoprecipitated anti-FLAG-tagged agarose beads, and subjected to immunoblotting with the indicated antibodies. K , HT1080 cells were transfected with FLAG-Empty or FLAG-HSP90 (WT/C521A) plasmid for 24 h and treated with Na 2 S 4 (100 μM) for indicated periods. Cell lysates were subjected to immunoblotting with the indicated antibodies. All data are representative of at least three independent experiments. HSF, heat shock factor; HSP, heat shock protein; PARP-1, poly (ADP-ribose) polymerase-1; RSS, reactive sulfur species.

Article Snippet: HT1080 cells were transfected with 10 nM nontargeting siRNA pool (Dharmacon) as control or HSP70 siRNAs using Lipofectamine RNAiMAX Transfection Reagent (Invitrogen), according to the manufacturer’s instructions.

Techniques: Real-time Polymerase Chain Reaction, Control, Western Blot, Transfection, Plasmid Preparation, Immunoprecipitation, Concentration Assay

Journal: Current biology : CB

Article Title: The RIF1-PP1 Axis Controls Abscission Timing in Human Cells.

doi: 10.1016/j.cub.2019.02.037

Figure Lengend Snippet: Figure 2. RIF1 Regulates Abscission Timing Independently of the Presence of Anaphase DNA Bridges (A) Representative immunofluorescence images for BLM, PICH, RPA, RIF1 (green in each case), and tubulin (tubulin; red) in cytokinetic HT1080 cells. (B) Representative images of asynchronously growing HT1080 cells transfected with either a control siRNA or RIF1 siRNA. (C) HT1080 cells in cytokinesis lacking a chromatin bridge were counted, and the number in each case was plotted as a percentage of total cell number (n > 400). (D) Quantification of abscission time derived from live-cell imaging (n > 33). (E) Still pictures derived from live imaging of U2OS cells lacking chromatin bridges stably expressing mEGFP-histone H2B and mRFP-a-tubulin following 48-h transfection with either a control siRNA or RIF1 siRNA. (F) Quantification of the percentage of HT1080 cells displaying a RIF1 immunofluorescence signal at the midbody in presence or absence of ICRF-193 (n > 50). (G) Representative immunofluorescence images for RIF1 (green) and tubulin (red) of HT1080 cells at the cytokinetic stage treated with siControl or siPICH for 48 h.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Histone H3 New England Biolabs Cat# M2503S Aurora B Abcam Cat# ab51435 PP1g Dr. Jakob Nilsson lab N/A GST-tagged CHMP4C: WT This study N/A GST-tagged CHMP4C: S210A This study N/A GST-tagged CHMP4C: S214AS215A This study N/A Experimental Models: Cell Lines U2OS Cell Line, human, (Sex: Female) ATCC ATCC HTB-96 HeLa Cell Line, human, (Sex: Female) ATCC ATCC CCL-2 HT1080 Cell Line, human, (Sex: Male) ATCC ATCC CCL-121 Flp-In T-RExU2OS pcDNA5/FRT/TO-GFP, (Sex: Female) This study N/A Flp-In T-RExU2OS pcDNA5/FRT/TO-GFP-RIF1, (Sex: Female) This study N/A Flp-In T-RExU2OS pcDNA5/FRT/TO-GFP-RIF1-pp1bs, (Sex: Female) This study N/A HeLa-hPP1a, (Sex: Female) Dr. Jakob Nilsson lab N/A HeLa-hPP1b, (Sex: Female) Dr. Jakob Nilsson lab N/A HeLa-hPP1g, (Sex: Female) Dr. Jakob Nilsson lab N/A U2OS-H2B-GFP_mCherry-a-tubulin, (Sex: Female) This study N/A Oligonucleotides siRNA targeting sequence: RIF1 #1: AAGAAUGAGCCCCUAGGGAAA [41] N/A siRNA targeting sequence: RIF1 #2: AGACGGUGCUCUAUUGUU Dharmacon Cat# D-027983-02 siRNA targeting sequence: PICH: AGUAGGUGGUGUCGGUUUA Dharmacon Cat# L-031851-01 siRNA targeting sequence: CHMP4C: GUAGAGGAGUCUUAUAUGA [8] N/A siRNA targeting sequence: PP1 g: GCCUAUCCUACUAGAACUU [42] N/A The Silencer-Select Control siRNA 2 Ambion Cat# 4390846 Recombinant DNA pcDNA5/FRT/TO-GFP-RIF1 Dr. Anne Donaldson lab N/A pcDNA5/FRT/TO-GFP-RIF1-pp1bs Dr. Anne Donaldson lab N/A pcDNA5/FRT/TO-GFP Dr. Anne Donaldson lab N/A pCR3.1 GFP-EXN/CHMP4C Dr. George Zachos lab N/A pCR3.1 GFP-EXN/CHMP4C-S210A Dr. George Zachos lab N/A pCR3.1 GFP-EXN/CHMP4C -S210D Dr. George Zachos lab N/A pGEX-4T-1/hCHMP4C Dr. George Zachos lab N/A pGEX-4T-1/hCHMP4CS210A This Study N/A pGEX-4T-1/hCHMP4CS214A, S215A This study N/A Software and Algorithms Prism Graphpad N/A Fiji ImageJ N/A Other Lipofectamine RNAimax Life Technologies Cat#13778075 FuGENE HD Promega Cat# E2311

Techniques: Transfection, Control, Derivative Assay, Live Cell Imaging, Imaging, Stable Transfection, Expressing

Journal: Current biology : CB

Article Title: The RIF1-PP1 Axis Controls Abscission Timing in Human Cells.

doi: 10.1016/j.cub.2019.02.037

Figure Lengend Snippet: Figure 4. Aurora B and PP1 Play Opposing Roles in the Regulation of Abscission Timing (A) Quantification of abscission time under the indicated conditions (n > 30). (B) Quantification of the percentage of binucleated HT1080 cells in an asynchronously growing cell population treated with the indicated drugs (n > 500).

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Histone H3 New England Biolabs Cat# M2503S Aurora B Abcam Cat# ab51435 PP1g Dr. Jakob Nilsson lab N/A GST-tagged CHMP4C: WT This study N/A GST-tagged CHMP4C: S210A This study N/A GST-tagged CHMP4C: S214AS215A This study N/A Experimental Models: Cell Lines U2OS Cell Line, human, (Sex: Female) ATCC ATCC HTB-96 HeLa Cell Line, human, (Sex: Female) ATCC ATCC CCL-2 HT1080 Cell Line, human, (Sex: Male) ATCC ATCC CCL-121 Flp-In T-RExU2OS pcDNA5/FRT/TO-GFP, (Sex: Female) This study N/A Flp-In T-RExU2OS pcDNA5/FRT/TO-GFP-RIF1, (Sex: Female) This study N/A Flp-In T-RExU2OS pcDNA5/FRT/TO-GFP-RIF1-pp1bs, (Sex: Female) This study N/A HeLa-hPP1a, (Sex: Female) Dr. Jakob Nilsson lab N/A HeLa-hPP1b, (Sex: Female) Dr. Jakob Nilsson lab N/A HeLa-hPP1g, (Sex: Female) Dr. Jakob Nilsson lab N/A U2OS-H2B-GFP_mCherry-a-tubulin, (Sex: Female) This study N/A Oligonucleotides siRNA targeting sequence: RIF1 #1: AAGAAUGAGCCCCUAGGGAAA [41] N/A siRNA targeting sequence: RIF1 #2: AGACGGUGCUCUAUUGUU Dharmacon Cat# D-027983-02 siRNA targeting sequence: PICH: AGUAGGUGGUGUCGGUUUA Dharmacon Cat# L-031851-01 siRNA targeting sequence: CHMP4C: GUAGAGGAGUCUUAUAUGA [8] N/A siRNA targeting sequence: PP1 g: GCCUAUCCUACUAGAACUU [42] N/A The Silencer-Select Control siRNA 2 Ambion Cat# 4390846 Recombinant DNA pcDNA5/FRT/TO-GFP-RIF1 Dr. Anne Donaldson lab N/A pcDNA5/FRT/TO-GFP-RIF1-pp1bs Dr. Anne Donaldson lab N/A pcDNA5/FRT/TO-GFP Dr. Anne Donaldson lab N/A pCR3.1 GFP-EXN/CHMP4C Dr. George Zachos lab N/A pCR3.1 GFP-EXN/CHMP4C-S210A Dr. George Zachos lab N/A pCR3.1 GFP-EXN/CHMP4C -S210D Dr. George Zachos lab N/A pGEX-4T-1/hCHMP4C Dr. George Zachos lab N/A pGEX-4T-1/hCHMP4CS210A This Study N/A pGEX-4T-1/hCHMP4CS214A, S215A This study N/A Software and Algorithms Prism Graphpad N/A Fiji ImageJ N/A Other Lipofectamine RNAimax Life Technologies Cat#13778075 FuGENE HD Promega Cat# E2311

Techniques: